I had a breakthrough.
You know in tv shows when they say "What's Plan B?" I have my plan B. Plan B answers my prayers, more than one. Even if Rhumkorff's plans do not work, I have my Plan B.
This is my last blog post for a while. There is a storm coming. They say it is going to be a big one. Lots of snow. Where I am, there is always snow. But not like this, apparently.
Good bye, my friends. You will learn the whole truth... soon. I promise.
Until the storm clears, your friend, Jian.
http://ancestornovel.com
Sunday, April 1, 2007
Wednesday, March 28, 2007
AUTOMATED POST 615
GODMACHINE AUTOMATED EMAIL SYSTEM...
...
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---Iamlockedinthelab---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---iamgoingtotrytousemygodmachinetopostthis---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---withoutrhumkorffseeingit---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---heistoobusyinthelab---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---youneedtohearthetruth---
---ihopethegodmachinewillpostthisformethroughthefirewalls--
---illdeleteittomorrowbeforerhumkorffseesit---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---youknowmydreamsyouknowmywork---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---iwillbeatmynightmare---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---thegodmachinewillcreatetheancestorgenome---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---iwillmakemylifelivableagain---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---thetruth---
GODMACHINE AUTOMATED EMAIL SYSTEM...
...
GODMACHINE AUTOMATED EMAIL 615 END---
http://ancestornovel.com
...
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---Iamlockedinthelab---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---iamgoingtotrytousemygodmachinetopostthis---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---withoutrhumkorffseeingit---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---heistoobusyinthelab---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---youneedtohearthetruth---
---ihopethegodmachinewillpostthisformethroughthefirewalls--
---illdeleteittomorrowbeforerhumkorffseesit---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---youknowmydreamsyouknowmywork---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---iwillbeatmynightmare---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---thegodmachinewillcreatetheancestorgenome---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---iwillmakemylifelivableagain---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---thetruth---
GODMACHINE AUTOMATED EMAIL SYSTEM...
...
GODMACHINE AUTOMATED EMAIL 615 END---
http://ancestornovel.com
Monday, March 26, 2007
62.25%
62.25% Embryo Viability...
Two weeks ago we were at 59.43%. Every new species, every set of mammalian DNA I add to my God Machine gets us closer to viability. Every percentage point gets us closer to the day that those cow macrophages accept our ancestor zygotes as bovine in nature--allowing us to implant our embryos into our cows. Every step gets us closer to creating these ancestors, animals with organs that we will be able to harvest and use in transplant surgeries now and forever.
My feet tingle at the possibilities. I have spoken about my tingle. Well I haven't told you my secret--the secret that had my feet tingling for a day and a half.
I'm encoding this post so Rhumkorff will not see it. Only you will see it.
I know a way to increase our viablity. I proved it earlier today. I can make it work. I destroyed the evidence, because it is my secret.
Rhumkorff blames me for losing lives every day. Not for much longer.
The last time Magnus was here, I told you about playing chess with him. I didn't tell you this part of it. Early on in the game he sacrificed his queen. It would have been a worthless move, but like I told you, I was scared for my life once I saw his arms... the bandages... I made sure I exposed my queen's bishop and knight, making his sacrifice worth it.
He knew I was throwing the game. He knew I was scared. Magnus is not a fool, not like Andy. Near the end, he asked me "Who said 'The end justifies the means?'" I said I thought it was Ovid. He smiled at me and said "I don't know who that is, but I have my own saying. 'Fuck 'em if they can't take it.'"
I hate Magnus Paglione. But he is right. I will break the rules if I have to, but I will ceate a viable zygote.
Check...
Two weeks ago we were at 59.43%. Every new species, every set of mammalian DNA I add to my God Machine gets us closer to viability. Every percentage point gets us closer to the day that those cow macrophages accept our ancestor zygotes as bovine in nature--allowing us to implant our embryos into our cows. Every step gets us closer to creating these ancestors, animals with organs that we will be able to harvest and use in transplant surgeries now and forever.
My feet tingle at the possibilities. I have spoken about my tingle. Well I haven't told you my secret--the secret that had my feet tingling for a day and a half.
I'm encoding this post so Rhumkorff will not see it. Only you will see it.
I know a way to increase our viablity. I proved it earlier today. I can make it work. I destroyed the evidence, because it is my secret.
Rhumkorff blames me for losing lives every day. Not for much longer.
The last time Magnus was here, I told you about playing chess with him. I didn't tell you this part of it. Early on in the game he sacrificed his queen. It would have been a worthless move, but like I told you, I was scared for my life once I saw his arms... the bandages... I made sure I exposed my queen's bishop and knight, making his sacrifice worth it.
He knew I was throwing the game. He knew I was scared. Magnus is not a fool, not like Andy. Near the end, he asked me "Who said 'The end justifies the means?'" I said I thought it was Ovid. He smiled at me and said "I don't know who that is, but I have my own saying. 'Fuck 'em if they can't take it.'"
I hate Magnus Paglione. But he is right. I will break the rules if I have to, but I will ceate a viable zygote.
Check...
Labels:
ancestor,
chess,
genomes,
God Machine,
Rhumkorff
Sunday, March 25, 2007
Sewing...
I don't know how to sew. I never learned how. But I do sew... in my nightmares.
My panda, my toy. I have ripped its appendages off. I sew different appendages on. I don't know how to sew, so I poke myself with the needle over and over again.
I woke up with two bloody fingers this morning. How can I bleed from a dream?
I have a plan. I will talk to you about it tomorrow. Tonight I solved an issue (I think) with a particularly troublesome sequence of DNA, with the help of an extinct species of ermine. Tomorrow I'll know for sure.
http://ancestornovel.com
My panda, my toy. I have ripped its appendages off. I sew different appendages on. I don't know how to sew, so I poke myself with the needle over and over again.
I woke up with two bloody fingers this morning. How can I bleed from a dream?
I have a plan. I will talk to you about it tomorrow. Tonight I solved an issue (I think) with a particularly troublesome sequence of DNA, with the help of an extinct species of ermine. Tomorrow I'll know for sure.
http://ancestornovel.com
Friday, March 23, 2007
I'm sorry
I did not post yesterday. I was in bed asleep.
I had this dream. I was out in the snow. The monster was there again. This time it had a baby doll's head, a cow's body, the legs of a horse, and an alligator's tail. It sat in front of me. We faced each other in a game of ... what's it called when you stare without blinking?
I was going to win the game. But then P.J. was there. He placed a jacket around my shoulders and the monster was gone. I wasn't dreaming at all. I was really sitting outside. P.J. saw me walk out of the station's security doors on the security monitor. He saved me.
I hadn't slept in 75 hours. Rhumkorff got me good for blogging about him. I hate everything about his place now, except for P.J. and Teyshawn.
I go to work now.
http://ancestornovel.com
I had this dream. I was out in the snow. The monster was there again. This time it had a baby doll's head, a cow's body, the legs of a horse, and an alligator's tail. It sat in front of me. We faced each other in a game of ... what's it called when you stare without blinking?
I was going to win the game. But then P.J. was there. He placed a jacket around my shoulders and the monster was gone. I wasn't dreaming at all. I was really sitting outside. P.J. saw me walk out of the station's security doors on the security monitor. He saved me.
I hadn't slept in 75 hours. Rhumkorff got me good for blogging about him. I hate everything about his place now, except for P.J. and Teyshawn.
I go to work now.
http://ancestornovel.com
Wednesday, March 21, 2007
I been up 48 hours straight...
rhumkorff is crazy man. i have been entering dna sequences for four new mammals. he brings food and dr pepper to my desk every two hours. he yells at me, tells me i'm useless. i raised my voice once and he yelled for five minutes straight... tells me the project will fail and it will be my fault. he called me a fat waste. teyshawn stepped between him and me. he wouldn't say anything to stop him. just kept him from hitting me. he would not hit me, would he?
http://ancestornovel.com
maybe he is right. maybe people dying because i am too slow. maybe ancestor is already in my machine, but the sequences i code by hand are causing too many issues. the cow macrophages won't allow the embryos to survive over five minutes now. i am missing something. i am patching together so many things. i hear the laughing from the corner. iseethemonster. he is there. i will ignore it. go away. i have work to do. you are not my friends. only rhumkorff reads my blog apparently. colding is my only friend. i will will sfvsdaasvb
http://ancestornovel.com
maybe he is right. maybe people dying because i am too slow. maybe ancestor is already in my machine, but the sequences i code by hand are causing too many issues. the cow macrophages won't allow the embryos to survive over five minutes now. i am missing something. i am patching together so many things. i hear the laughing from the corner. iseethemonster. he is there. i will ignore it. go away. i have work to do. you are not my friends. only rhumkorff reads my blog apparently. colding is my only friend. i will will sfvsdaasvb
Tuesday, March 20, 2007
Damn him!
Rhumkorff woke me up at 4:30 am and we are going through another round of testing. I didn't have time to check, but I bet he read my blog. I could be fired for this.
What am I thinking? He can't fire me. He needs me too much.
Gotta run. Claudette Overgard is yelling... she's mad at ME because Klaus woke her up too. Not my fault.
http://ancestornovel.com
What am I thinking? He can't fire me. He needs me too much.
Gotta run. Claudette Overgard is yelling... she's mad at ME because Klaus woke her up too. Not my fault.
http://ancestornovel.com
Subscribe to:
Posts (Atom)