Sunday, April 1, 2007
A Storm is Coming...
You know in tv shows when they say "What's Plan B?" I have my plan B. Plan B answers my prayers, more than one. Even if Rhumkorff's plans do not work, I have my Plan B.
This is my last blog post for a while. There is a storm coming. They say it is going to be a big one. Lots of snow. Where I am, there is always snow. But not like this, apparently.
Good bye, my friends. You will learn the whole truth... soon. I promise.
Until the storm clears, your friend, Jian.
http://ancestornovel.com
Wednesday, March 28, 2007
AUTOMATED POST 615
...
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---Iamlockedinthelab---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---iamgoingtotrytousemygodmachinetopostthis---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---withoutrhumkorffseeingit---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---heistoobusyinthelab---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---youneedtohearthetruth---
---ihopethegodmachinewillpostthisformethroughthefirewalls--
---illdeleteittomorrowbeforerhumkorffseesit---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---youknowmydreamsyouknowmywork---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---iwillbeatmynightmare---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---thegodmachinewillcreatetheancestorgenome---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---iwillmakemylifelivableagain---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---thetruth---
GODMACHINE AUTOMATED EMAIL SYSTEM...
...
GODMACHINE AUTOMATED EMAIL 615 END---
http://ancestornovel.com
Monday, March 26, 2007
62.25%
Two weeks ago we were at 59.43%. Every new species, every set of mammalian DNA I add to my God Machine gets us closer to viability. Every percentage point gets us closer to the day that those cow macrophages accept our ancestor zygotes as bovine in nature--allowing us to implant our embryos into our cows. Every step gets us closer to creating these ancestors, animals with organs that we will be able to harvest and use in transplant surgeries now and forever.
My feet tingle at the possibilities. I have spoken about my tingle. Well I haven't told you my secret--the secret that had my feet tingling for a day and a half.
I'm encoding this post so Rhumkorff will not see it. Only you will see it.
I know a way to increase our viablity. I proved it earlier today. I can make it work. I destroyed the evidence, because it is my secret.
Rhumkorff blames me for losing lives every day. Not for much longer.
The last time Magnus was here, I told you about playing chess with him. I didn't tell you this part of it. Early on in the game he sacrificed his queen. It would have been a worthless move, but like I told you, I was scared for my life once I saw his arms... the bandages... I made sure I exposed my queen's bishop and knight, making his sacrifice worth it.
He knew I was throwing the game. He knew I was scared. Magnus is not a fool, not like Andy. Near the end, he asked me "Who said 'The end justifies the means?'" I said I thought it was Ovid. He smiled at me and said "I don't know who that is, but I have my own saying. 'Fuck 'em if they can't take it.'"
I hate Magnus Paglione. But he is right. I will break the rules if I have to, but I will ceate a viable zygote.
Check...
Sunday, March 25, 2007
Sewing...
My panda, my toy. I have ripped its appendages off. I sew different appendages on. I don't know how to sew, so I poke myself with the needle over and over again.
I woke up with two bloody fingers this morning. How can I bleed from a dream?
I have a plan. I will talk to you about it tomorrow. Tonight I solved an issue (I think) with a particularly troublesome sequence of DNA, with the help of an extinct species of ermine. Tomorrow I'll know for sure.
http://ancestornovel.com
Friday, March 23, 2007
I'm sorry
I had this dream. I was out in the snow. The monster was there again. This time it had a baby doll's head, a cow's body, the legs of a horse, and an alligator's tail. It sat in front of me. We faced each other in a game of ... what's it called when you stare without blinking?
I was going to win the game. But then P.J. was there. He placed a jacket around my shoulders and the monster was gone. I wasn't dreaming at all. I was really sitting outside. P.J. saw me walk out of the station's security doors on the security monitor. He saved me.
I hadn't slept in 75 hours. Rhumkorff got me good for blogging about him. I hate everything about his place now, except for P.J. and Teyshawn.
I go to work now.
http://ancestornovel.com
Wednesday, March 21, 2007
I been up 48 hours straight...
http://ancestornovel.com
maybe he is right. maybe people dying because i am too slow. maybe ancestor is already in my machine, but the sequences i code by hand are causing too many issues. the cow macrophages won't allow the embryos to survive over five minutes now. i am missing something. i am patching together so many things. i hear the laughing from the corner. iseethemonster. he is there. i will ignore it. go away. i have work to do. you are not my friends. only rhumkorff reads my blog apparently. colding is my only friend. i will will sfvsdaasvb
Tuesday, March 20, 2007
Damn him!
What am I thinking? He can't fire me. He needs me too much.
Gotta run. Claudette Overgard is yelling... she's mad at ME because Klaus woke her up too. Not my fault.
http://ancestornovel.com
Monday, March 19, 2007
Rhumkorff is Khu Wu!
Klaus thinks I cannot see his blog... thinks I am blocked by this silly firewall. He is despicable (khu wu). He is a... I don't know the word.
He is the type of person that takes credit for other people's hard work. True, he came up with the idea for the ancestor project. Instead of attempting to create a chimera, animals such as pigs combined with human DNA, creating new species of creatures that would possess organs that human immune systems might accept... Rhumkorff came up with the idea of going back to the beginning... the beginning of mammalian life... our ANCESTOR.
You see, the problem with chimeras is a simple one. You build a pig with human DNA, you end up exposing those proteins to simple pig viruses. Then boom, you get a simple virus that jumps species, and you have a human epidemic worse than AIDS ten times over.
But our ancestor, a mammal that would have enough of our genetic blueprint within its DNA... ah, that would be so much safer than building a chimera.
Rhumkorff's great idea. Bah. Without Overgard, the geneticist that has successfully brought back the qagga from extinction by altering the genes of its living cousin, the zebra... without my God Machine which allows us to extrapolate the genetic data from hundreds of different mammals as we attempt to recreate this Ancestor... Rhumkorff would be nothing more than a man with a crazy idea... a man that as Mister Colding would say "talks out of his ass hole."
Ha ha... I'd like to see that.
Ah, I remember the word now. thesaurus.com helps me with my english... klaus is a megalomaniac.
I will beat this. I will prove to Klaus Rhumkorff that Lui Jiandan is more valuable than ten men.
http://ancestornovel.com
Sunday, March 18, 2007
The dream again...
But I see the doll now when I'm awake. I'm staring at it right now, in the corner. It mocks me. It watched our test today. No better than last time. All embryos dead within eleven minutes. Teyshawn suggested a change to how we create the outer membrane of the embyo. It might help us limit the number of chemical signals that escape from the inner lining of the embryo... what the god machine creates. If Tyshawn's suggestion works, it might get us closer...
PJ says that Bobby is coming for a visit soon. I hope he will bring me more samples of extinct or near-extinct creatures. I need more data. THAT is what I need most of all. Data will give us our Ancestor... and my dream monster will mock me no more.
http://ancestornovel.com
Saturday, March 10, 2007
My life IS a chess game
My da shi, my masters, always told me that life is different than chess because life is unpredictable. I disagree. My mind has always allowed me to increase the predictability of events that happen around me. My dreams fill in the gaps.
Because of this, I now know that very bad things are coming. The ancestor project... my work... Rhumkorff is like a rook that has an open board. P.J. may be my knight, but I don't think he will be able to save me...
I need a Dr. Pepper. Bye friends. I'll be back soon.
http://ancestornovel.com
Monday, March 5, 2007
Shiang Jing Ping...
I talk too much. Ma Jung Hwa!!
My machine! Rhumkorff calls it the God Machine. I use it to build DNA. FAST. Unlike computers, that double processing speed every eighteen months, with my program on my God Machine I can build DNA sequences 200 times faster than any program on any bank of computers in the world. But I still have fears.
Oh, there's Andy at my door. I must shut down now. He is Sah Gwa (a moron), but he is not blind.
You are my friends. I have more to share with you. I feel my time is running out... in so many ways.
http://ancestornovel.com/
Tuesday, February 27, 2007
I'm crying now...
He pulled me into a room and ordered me to play chess with him. He plays Andy every time he comes to visit us, but he never asked me to play.
I had him beat after five moves, and he didn't even know it. All I had to do was go through the motions.
But then I saw something that scared me so badly. He reached out for his queenside rook and I saw his forearm. It was covered with scars... and cuts that were only partially bandaged. I knew Magnus was scary, but this was crazy.
Then I looked in his eyes. I knew right then, if I won the game, he might kill me.
I ended it as quickly as possible. Andy was there, slapping Magnus on the shoulder and laughing at me. I bowed and hurried out of the room. I don't think I'll sleep much tonight.
http://ancestornovel.com
Wednesday, February 21, 2007
My Dreams
I hate dreams.
Ever since I began working as a geneticist, I have had nightmares. I dream of dolls, with animal parts. I dream of impossible creatures, some Frankenstein monsters that try to kill me over and over... even through I know in my heart that I have created these monsters myself.
Even though the work I do will help thousands of people every year, help them receive new organs, get a chance at a new life, it scares me too. I can zip and unzip strands of DNA to create new life. I can combine the DNA of different...
I'm sorry. I shouldn't be talking about this here. If Klaus knew what I was doing here, he would fire me... or worse.
But I know one reason I have these dreams. Because I have never made the time to have a family. Instead of a baby I dream of monsters. One day though, maybe I will have a baby. I can ask mr. colding to ... no, you dirty minds. I only need his DNA. I could hide things until it was too late for anyone to stop me. I am a big woman. I doubt anyone would notice me until I am ready to have the baby. HA HA
Sunday, February 11, 2007
The Police
mr. colding knew I was still in a bad mood about Magnus, so he had me stay in the common room tonight and watch the beginning of The Grammies. He had me watch the band called The Police play a song. Apparently they were very famous for a few years and then broke up because they couldn't get along well enough to stick together. mr. colding told me the three men in the band used to fight all the time... just like me and claus and claudette.
I think mr. colding was trying to make an analogy; like us three are capable of doing great things together, even though we fight all the time. I hope he is right.
http://ancestornovel.com
Thursday, February 8, 2007
Bad DAY
But it only got worse for me. Magnus hovered over me for at least an hour. He doesn't understand a word I say, due to my accent and the fact that he knows absolutely nothing about genetics. At one point he had his giant hands on the back of my chair while Claus was explaining why we... why we have only reached the point we are at in our work, and he pulls up on the back of my chair so hard I came up off the ground! I looked up at him, was going to tell him to stop, but his eyes scared me so. I ran out of the lab and came to my room. I cried until mister colding stopped in and told me Magnus had left. He brought me a doctor pepper too. He is so nice to me.
http://ancestornovel.com
Monday, February 5, 2007
Heroes! (and relief)
I didn't think I was going to get to see Heroes at all, with Magnus coming. But he has canceled his trip I guess. rhumkorff told me not to worry about it. I smile now.
Bye now. siler (silar) has escaped! I must go watch.
http://ancestornovel.com
Sunday, February 4, 2007
Super Bowl
I see it is raining very hard. They keep talking about the football being slick and slippery. They make footballs out of cow hide, right? I told mr. colding I think I can genetically engineer a cow that would produce tackier leather. He just laughed. I like it when he laughs. He laughs with me, not at me.
Magnus is supposed to visit next week, to tour our facility. He is the only man that scares me more than Claus. He is so huge. He played football, but not in the American league that has the super bowl.
At least tonight we have the football game. I'll worry about Magnus later.
http://ancestornovel.com
Wednesday, January 31, 2007
Chess...
That was one of the best days of my life, yes. I was so young. And much lighter. ha ha
Andy called me urlacker the other day. I thought he meant I 'lacked' something at first, but then mister colding told him to shut up and leave. I think urlacker is a football player. I am big, but I am not an urlacker. Andy is an... I can't write that word here.
mister colding says this sunday is the super football bowl. I get to see the urlacker, and the one that throws the football I like. I like the commercial where he says 'arm like rocket.' ha ha
http://ancestornovel.com/
Wednesday, January 24, 2007
Day, Night... they mean nothing
Besides, I don't like my dreams so much. Mister Colding, my only real friend... he says my dreams are because I drink too much Dr. Pepper. You try working 20 hour shifts without soda.
http://ancestornovel.com/
Tuesday, January 23, 2007
Heroes
The science is all sah gwa... silly, of course. As if you could use the human genome project to map specific genes and track people from around the world. You should hear Claudette (she is one of my co-workers... I hate her). She just sits in the corner when we watch Heroes, grunting whenever they say "Are you on the list?"
It is so funny.
http://ancestornovel.com/