GODMACHINE AUTOMATED EMAIL SYSTEM...
...
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---Iamlockedinthelab---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---iamgoingtotrytousemygodmachinetopostthis---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---withoutrhumkorffseeingit---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---heistoobusyinthelab---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---youneedtohearthetruth---
---ihopethegodmachinewillpostthisformethroughthefirewalls--
---illdeleteittomorrowbeforerhumkorffseesit---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---youknowmydreamsyouknowmywork---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---iwillbeatmynightmare---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---thegodmachinewillcreatetheancestorgenome---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---iwillmakemylifelivableagain---
ACTGGTCAGGATCCAGCTTAGGGATCAACTGGTCAGGATCCAGCTTAG
---thetruth---
GODMACHINE AUTOMATED EMAIL SYSTEM...
...
GODMACHINE AUTOMATED EMAIL 615 END---
http://ancestornovel.com
Wednesday, March 28, 2007
Monday, March 26, 2007
62.25%
62.25% Embryo Viability...
Two weeks ago we were at 59.43%. Every new species, every set of mammalian DNA I add to my God Machine gets us closer to viability. Every percentage point gets us closer to the day that those cow macrophages accept our ancestor zygotes as bovine in nature--allowing us to implant our embryos into our cows. Every step gets us closer to creating these ancestors, animals with organs that we will be able to harvest and use in transplant surgeries now and forever.
My feet tingle at the possibilities. I have spoken about my tingle. Well I haven't told you my secret--the secret that had my feet tingling for a day and a half.
I'm encoding this post so Rhumkorff will not see it. Only you will see it.
I know a way to increase our viablity. I proved it earlier today. I can make it work. I destroyed the evidence, because it is my secret.
Rhumkorff blames me for losing lives every day. Not for much longer.
The last time Magnus was here, I told you about playing chess with him. I didn't tell you this part of it. Early on in the game he sacrificed his queen. It would have been a worthless move, but like I told you, I was scared for my life once I saw his arms... the bandages... I made sure I exposed my queen's bishop and knight, making his sacrifice worth it.
He knew I was throwing the game. He knew I was scared. Magnus is not a fool, not like Andy. Near the end, he asked me "Who said 'The end justifies the means?'" I said I thought it was Ovid. He smiled at me and said "I don't know who that is, but I have my own saying. 'Fuck 'em if they can't take it.'"
I hate Magnus Paglione. But he is right. I will break the rules if I have to, but I will ceate a viable zygote.
Check...
Two weeks ago we were at 59.43%. Every new species, every set of mammalian DNA I add to my God Machine gets us closer to viability. Every percentage point gets us closer to the day that those cow macrophages accept our ancestor zygotes as bovine in nature--allowing us to implant our embryos into our cows. Every step gets us closer to creating these ancestors, animals with organs that we will be able to harvest and use in transplant surgeries now and forever.
My feet tingle at the possibilities. I have spoken about my tingle. Well I haven't told you my secret--the secret that had my feet tingling for a day and a half.
I'm encoding this post so Rhumkorff will not see it. Only you will see it.
I know a way to increase our viablity. I proved it earlier today. I can make it work. I destroyed the evidence, because it is my secret.
Rhumkorff blames me for losing lives every day. Not for much longer.
The last time Magnus was here, I told you about playing chess with him. I didn't tell you this part of it. Early on in the game he sacrificed his queen. It would have been a worthless move, but like I told you, I was scared for my life once I saw his arms... the bandages... I made sure I exposed my queen's bishop and knight, making his sacrifice worth it.
He knew I was throwing the game. He knew I was scared. Magnus is not a fool, not like Andy. Near the end, he asked me "Who said 'The end justifies the means?'" I said I thought it was Ovid. He smiled at me and said "I don't know who that is, but I have my own saying. 'Fuck 'em if they can't take it.'"
I hate Magnus Paglione. But he is right. I will break the rules if I have to, but I will ceate a viable zygote.
Check...
Labels:
ancestor,
chess,
genomes,
God Machine,
Rhumkorff
Sunday, March 25, 2007
Sewing...
I don't know how to sew. I never learned how. But I do sew... in my nightmares.
My panda, my toy. I have ripped its appendages off. I sew different appendages on. I don't know how to sew, so I poke myself with the needle over and over again.
I woke up with two bloody fingers this morning. How can I bleed from a dream?
I have a plan. I will talk to you about it tomorrow. Tonight I solved an issue (I think) with a particularly troublesome sequence of DNA, with the help of an extinct species of ermine. Tomorrow I'll know for sure.
http://ancestornovel.com
My panda, my toy. I have ripped its appendages off. I sew different appendages on. I don't know how to sew, so I poke myself with the needle over and over again.
I woke up with two bloody fingers this morning. How can I bleed from a dream?
I have a plan. I will talk to you about it tomorrow. Tonight I solved an issue (I think) with a particularly troublesome sequence of DNA, with the help of an extinct species of ermine. Tomorrow I'll know for sure.
http://ancestornovel.com
Friday, March 23, 2007
I'm sorry
I did not post yesterday. I was in bed asleep.
I had this dream. I was out in the snow. The monster was there again. This time it had a baby doll's head, a cow's body, the legs of a horse, and an alligator's tail. It sat in front of me. We faced each other in a game of ... what's it called when you stare without blinking?
I was going to win the game. But then P.J. was there. He placed a jacket around my shoulders and the monster was gone. I wasn't dreaming at all. I was really sitting outside. P.J. saw me walk out of the station's security doors on the security monitor. He saved me.
I hadn't slept in 75 hours. Rhumkorff got me good for blogging about him. I hate everything about his place now, except for P.J. and Teyshawn.
I go to work now.
http://ancestornovel.com
I had this dream. I was out in the snow. The monster was there again. This time it had a baby doll's head, a cow's body, the legs of a horse, and an alligator's tail. It sat in front of me. We faced each other in a game of ... what's it called when you stare without blinking?
I was going to win the game. But then P.J. was there. He placed a jacket around my shoulders and the monster was gone. I wasn't dreaming at all. I was really sitting outside. P.J. saw me walk out of the station's security doors on the security monitor. He saved me.
I hadn't slept in 75 hours. Rhumkorff got me good for blogging about him. I hate everything about his place now, except for P.J. and Teyshawn.
I go to work now.
http://ancestornovel.com
Wednesday, March 21, 2007
I been up 48 hours straight...
rhumkorff is crazy man. i have been entering dna sequences for four new mammals. he brings food and dr pepper to my desk every two hours. he yells at me, tells me i'm useless. i raised my voice once and he yelled for five minutes straight... tells me the project will fail and it will be my fault. he called me a fat waste. teyshawn stepped between him and me. he wouldn't say anything to stop him. just kept him from hitting me. he would not hit me, would he?
http://ancestornovel.com
maybe he is right. maybe people dying because i am too slow. maybe ancestor is already in my machine, but the sequences i code by hand are causing too many issues. the cow macrophages won't allow the embryos to survive over five minutes now. i am missing something. i am patching together so many things. i hear the laughing from the corner. iseethemonster. he is there. i will ignore it. go away. i have work to do. you are not my friends. only rhumkorff reads my blog apparently. colding is my only friend. i will will sfvsdaasvb
http://ancestornovel.com
maybe he is right. maybe people dying because i am too slow. maybe ancestor is already in my machine, but the sequences i code by hand are causing too many issues. the cow macrophages won't allow the embryos to survive over five minutes now. i am missing something. i am patching together so many things. i hear the laughing from the corner. iseethemonster. he is there. i will ignore it. go away. i have work to do. you are not my friends. only rhumkorff reads my blog apparently. colding is my only friend. i will will sfvsdaasvb
Tuesday, March 20, 2007
Damn him!
Rhumkorff woke me up at 4:30 am and we are going through another round of testing. I didn't have time to check, but I bet he read my blog. I could be fired for this.
What am I thinking? He can't fire me. He needs me too much.
Gotta run. Claudette Overgard is yelling... she's mad at ME because Klaus woke her up too. Not my fault.
http://ancestornovel.com
What am I thinking? He can't fire me. He needs me too much.
Gotta run. Claudette Overgard is yelling... she's mad at ME because Klaus woke her up too. Not my fault.
http://ancestornovel.com
Monday, March 19, 2007
Rhumkorff is Khu Wu!
http://blogs.genada.com/rhumkorrf/?p=3
Klaus thinks I cannot see his blog... thinks I am blocked by this silly firewall. He is despicable (khu wu). He is a... I don't know the word.
He is the type of person that takes credit for other people's hard work. True, he came up with the idea for the ancestor project. Instead of attempting to create a chimera, animals such as pigs combined with human DNA, creating new species of creatures that would possess organs that human immune systems might accept... Rhumkorff came up with the idea of going back to the beginning... the beginning of mammalian life... our ANCESTOR.
You see, the problem with chimeras is a simple one. You build a pig with human DNA, you end up exposing those proteins to simple pig viruses. Then boom, you get a simple virus that jumps species, and you have a human epidemic worse than AIDS ten times over.
But our ancestor, a mammal that would have enough of our genetic blueprint within its DNA... ah, that would be so much safer than building a chimera.
Rhumkorff's great idea. Bah. Without Overgard, the geneticist that has successfully brought back the qagga from extinction by altering the genes of its living cousin, the zebra... without my God Machine which allows us to extrapolate the genetic data from hundreds of different mammals as we attempt to recreate this Ancestor... Rhumkorff would be nothing more than a man with a crazy idea... a man that as Mister Colding would say "talks out of his ass hole."
Ha ha... I'd like to see that.
Ah, I remember the word now. thesaurus.com helps me with my english... klaus is a megalomaniac.
I will beat this. I will prove to Klaus Rhumkorff that Lui Jiandan is more valuable than ten men.
http://ancestornovel.com
Klaus thinks I cannot see his blog... thinks I am blocked by this silly firewall. He is despicable (khu wu). He is a... I don't know the word.
He is the type of person that takes credit for other people's hard work. True, he came up with the idea for the ancestor project. Instead of attempting to create a chimera, animals such as pigs combined with human DNA, creating new species of creatures that would possess organs that human immune systems might accept... Rhumkorff came up with the idea of going back to the beginning... the beginning of mammalian life... our ANCESTOR.
You see, the problem with chimeras is a simple one. You build a pig with human DNA, you end up exposing those proteins to simple pig viruses. Then boom, you get a simple virus that jumps species, and you have a human epidemic worse than AIDS ten times over.
But our ancestor, a mammal that would have enough of our genetic blueprint within its DNA... ah, that would be so much safer than building a chimera.
Rhumkorff's great idea. Bah. Without Overgard, the geneticist that has successfully brought back the qagga from extinction by altering the genes of its living cousin, the zebra... without my God Machine which allows us to extrapolate the genetic data from hundreds of different mammals as we attempt to recreate this Ancestor... Rhumkorff would be nothing more than a man with a crazy idea... a man that as Mister Colding would say "talks out of his ass hole."
Ha ha... I'd like to see that.
Ah, I remember the word now. thesaurus.com helps me with my english... klaus is a megalomaniac.
I will beat this. I will prove to Klaus Rhumkorff that Lui Jiandan is more valuable than ten men.
http://ancestornovel.com
Sunday, March 18, 2007
The dream again...
I can't take this nightmare anymore. Actually it is a daymare now (is that a word?). I see my panda, my favorite doll from my childhood, with parts from all of these other animals and dolls, all sewn together. I know I have created this thing, this creature with the alligator head. I feel the pinpricks in my dreams. I've awakened and seen my bloody fingers... PJ says I must have bitten my fingernails, but I know better.
But I see the doll now when I'm awake. I'm staring at it right now, in the corner. It mocks me. It watched our test today. No better than last time. All embryos dead within eleven minutes. Teyshawn suggested a change to how we create the outer membrane of the embyo. It might help us limit the number of chemical signals that escape from the inner lining of the embryo... what the god machine creates. If Tyshawn's suggestion works, it might get us closer...
PJ says that Bobby is coming for a visit soon. I hope he will bring me more samples of extinct or near-extinct creatures. I need more data. THAT is what I need most of all. Data will give us our Ancestor... and my dream monster will mock me no more.
http://ancestornovel.com
But I see the doll now when I'm awake. I'm staring at it right now, in the corner. It mocks me. It watched our test today. No better than last time. All embryos dead within eleven minutes. Teyshawn suggested a change to how we create the outer membrane of the embyo. It might help us limit the number of chemical signals that escape from the inner lining of the embryo... what the god machine creates. If Tyshawn's suggestion works, it might get us closer...
PJ says that Bobby is coming for a visit soon. I hope he will bring me more samples of extinct or near-extinct creatures. I need more data. THAT is what I need most of all. Data will give us our Ancestor... and my dream monster will mock me no more.
http://ancestornovel.com
Labels:
ancestor,
dreams,
extinction,
genetic engineering,
nightmare,
teyshawn
Saturday, March 10, 2007
My life IS a chess game
Chess is life... you see the board... you see the pieces... where the lines of force are... where the board is influenced by the pieces on both sides.
My da shi, my masters, always told me that life is different than chess because life is unpredictable. I disagree. My mind has always allowed me to increase the predictability of events that happen around me. My dreams fill in the gaps.
Because of this, I now know that very bad things are coming. The ancestor project... my work... Rhumkorff is like a rook that has an open board. P.J. may be my knight, but I don't think he will be able to save me...
I need a Dr. Pepper. Bye friends. I'll be back soon.
http://ancestornovel.com
My da shi, my masters, always told me that life is different than chess because life is unpredictable. I disagree. My mind has always allowed me to increase the predictability of events that happen around me. My dreams fill in the gaps.
Because of this, I now know that very bad things are coming. The ancestor project... my work... Rhumkorff is like a rook that has an open board. P.J. may be my knight, but I don't think he will be able to save me...
I need a Dr. Pepper. Bye friends. I'll be back soon.
http://ancestornovel.com
Labels:
ancestor,
chess,
dr. pepper,
dreams,
Rhumkorff
Monday, March 5, 2007
Shiang Jing Ping...
I have been called Jing Chai (brilliant) many times during my life. Lately, though, Rhumkorrf only calls me Shiang Jing Ping (crazy). I can't help my dreams. I see animals that cannot exist. I see alligator heads, even though my machine has no DNA of alligators or crocodiles. We deal with animals that can lead us to the ancestor...
I talk too much. Ma Jung Hwa!!
My machine! Rhumkorff calls it the God Machine. I use it to build DNA. FAST. Unlike computers, that double processing speed every eighteen months, with my program on my God Machine I can build DNA sequences 200 times faster than any program on any bank of computers in the world. But I still have fears.
Oh, there's Andy at my door. I must shut down now. He is Sah Gwa (a moron), but he is not blind.
You are my friends. I have more to share with you. I feel my time is running out... in so many ways.
http://ancestornovel.com/
I talk too much. Ma Jung Hwa!!
My machine! Rhumkorff calls it the God Machine. I use it to build DNA. FAST. Unlike computers, that double processing speed every eighteen months, with my program on my God Machine I can build DNA sequences 200 times faster than any program on any bank of computers in the world. But I still have fears.
Oh, there's Andy at my door. I must shut down now. He is Sah Gwa (a moron), but he is not blind.
You are my friends. I have more to share with you. I feel my time is running out... in so many ways.
http://ancestornovel.com/
Subscribe to:
Posts (Atom)